irenecupcake9194 irenecupcake9194

25-08-2022
Business

contestada

If housing starts were 17,000 and commercial construction was 3,200, what would be the best estimate of lumber sales?

Respuesta :

Otras preguntas

Suppose a local office store has a press that can print 54,000 brochures per hour. How many brochures can be printed during a 3 1 4 hour run?

a) x² + ax + b = (x-3)² - a where a and b are integers. Work out the values of a and b.

If (x+1) is a factor p(x)= x²+x+2 then find the value of X.

All numbers less than 4 or greater than or equal to -1. Write the compound inequality in compact form

project plan project title: objective:1.2.3. ingredients/tools procedures:1.2.3.4.5. output

cell membranes are flexible in order to _____. A) repel molecules B) attract molecules C) adapt to constant conditions D) adapt to changing conditions

Solve the following quadratic equation using the zero product property. 2(6-x)(x+5)=0

The paragraph contains several sentence fragments. Decide if the selection in bold needs to be revised or if it is correct as is. Near the Normandy coast of nor

Find the real roots of the equation 4x⁴ + 3x² - 1 = 0.

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I