mackenziemcmutry430 mackenziemcmutry430

26-09-2022
History

contestada

How did bonsu understand the slave trade in its significance for the his kingdom?

Respuesta :

Otras preguntas

The spread of ideas during the Renaissance was MOST affected by. A) luthers religious conversion. B) the support of the Catho

Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

· Heart muscle receives its oxygen and nutrient supply from o atria o ventricles o aorta o pulmonary veins o coronary arteries · The "cushion" between bones in

How can you use this document to argue that imperialism(colonization) was one underlying cause of world war I?

When a cell related to immunity activates only in reaction to a specific pathogen, it is called _____. (Points : 4) inducibility clonality lymphocytes T lymphoc

PLEASE HELP AND EXPLAIN!!! (ASAP) A freight train left Seoul and traveled north at an average speed of 15.6 km/h. A passenger train left 3.9 hours later and tra

In hexagonal writing and analysis of literary devices explores

Piaget believed that language helped foster cognitive development. Please select the best answer from the choices provided True or False

Convert 2x - 3y + 1 = 0 to slope-intercept form