ck424242 ck424242
  • 26-02-2024
  • Biology
contestada

fill in with the mRNA strand, then translate to the amino acid sequence using this chart. Remember to always start with the start condon, and end with the stop condon. (Condon = 3 rucleotides) DNA: ATGTTTGCATACCAAGGCTAAATTTTC TRANSCRIPTION: mRNA: pROTEIN (AMINO ACID SEQUENCE): Translation

Respuesta :

Otras preguntas

Which is the number, which when squared and added to 12 becomes seven times its value ?
Why do some countries have to adopt more than one standard time ?
What were the two main reasons Spain sent expeditions to the Americas?
write an equation of the line that is:   a) parallel to the line y=2x-4, and has a y-intercept of 7   b) parallel to the line y-3x=6, and has a y-intercept of
whats the name of HOCl AND HClO?
-3x+11=4x+2-(2x-4) Please solve this problem with work. Thanks!
Two angles are complementary. They have measures of (7x + 2)° and (3x – 2)°, respectively. What is the value of x?18090910
Define unit of electric work (JOULE) in relation to quantity of charge and potential difference.
In the poem the inchcape rock tell the character of sir ralph which is present in every human being
Why do some countries have to adopt more than one standard time ?