faithSH777 faithSH777

22-03-2024
Mathematics

contestada

What is 7 to the power of 6 divided by 7 to the power of -3 using a base and exponent

Respuesta :

Otras preguntas

Question 5 Unsaved Our bodies main energy source is found in Question 5 options: A. Proteins B. Fats C. Carbohydrates D. Vitamins

what can people do to reduce global warming???

02 g of a sugar (molar mass = 360.4 g/mol) is dissolved in water to make 100.0 ml of solution. what is the molarity of this sweet solution

the volume of a cone with a 30-millimeter radius is 9,420 cubic millimeters.what is the height of the cone to the nearest millimeter?

A football team has 5 freshman, 8 sophmores, 11 juniors, and 16 seniors. If two are chosen at random to participate in the coin toss, what the probability that

When a pollutant is removed from the air by a natural process it_____? Distrupts natural processes Ends up elsewhere Is gone forever Causes chemical reaction

you are wrapping a present for a birthday party. The box length is 12 ft, width is 6 ft, and the depth is 3 ft. What is the least amount of wrapping paper you n

Using shadows in a black and white image adds to... A. The visual basis of the image B. The camera overcast layer C. It’s depth D. It’s transfer function

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Amy is conducting a survey of dating attitudes and behaviors among young adults as part of her master's thesis work. amy distributes questionnaires to 200 rando