flakitaermosapdvm2w flakitaermosapdvm2w

24-08-2018
Computers and Technology

contestada

when happens when the quantity of a good supplied at a given price is greater than the quantity demanded

Respuesta :

Аноним Аноним

24-08-2018

If there is a bigger supply than demand, it is called a surplus.

Answer Link

jimmyb975 jimmyb975

26-08-2018

The price would be lowered

Answer Link

Otras preguntas

The US labor movement grew out of the conditions of 4. the Great Depression 3. the Industrial Revolution the progressive movement . World War I Please select th

To add or subtract linear expressions combine ____ terms.A. leadingB. like

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please

What is the goal of a press release?

Solve the system of equations

Notable Domestic Events of Reagan's Presidency?

7+ 4h – k h = 2 and k = 12.

Colt is reading in his social studies book. A labyrinth of pruned bushes in a large garden. A labyrinth is a path that twists and turns but leads into a center

Writea letter to your friend telling him/how youhave been spending yourour timeе оhomesince chool took a break.

What happened in Russia as a resul of actions taken by peter the great? 1.) Russia was weakened by French invasions. 2.)Catholicism was adopted as the state rel