Seudónimo Seudónimo
  • 22-09-2018
  • Mathematics
contestada

Limit of y--> infinity Y = x^2 + 1/x^2

Respuesta :

Bouftou
Bouftou Bouftou
  • 22-09-2018

As x approaches infinity the value of the function Y approaches infinity. There is a vertical asymptote at x = 0 (Solve denominator for x) and since the degree of the numerator is greater than the denominator there are no horizontal asymptotes. You can simplify the limit by merging the expression into (x^4 + 1)/x^2 and dropping the one and simplifying to x^2 which in x^2 as x approaches infinity Y approaches infinity. Hope that helps!

Answer Link

Otras preguntas

A 54.2 L sample of gas at 115 K is heated to 345 K, at constant pressure. What volume does the gas now occupy?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
When is cash pulled out of circulation
I Prove that Cos(90-θ)/1+sin(90-θ) +1+sin(90-θ) /cos(90-θ) =2
Which viruse reproduces & what reproductive cell ?
Desert animals need to concentrate urine. What structural changes in the kidney would be associated with a kidney that is exceptionally good at concentrating ur
Circle the preposition in these sentences We were exhausted because our flight arrived at 4am.
Write your question here (Keep it simple and clear to get the best answer)what are the different types of bleaching agent's
How do bones in a fossil survive for millions of years?
Use these words in a sentence proton neutron and isotope