lillyheartfilia
lillyheartfilia lillyheartfilia
  • 24-11-2018
  • Mathematics
contestada

Help me I’m in a rush!!

Help me Im in a rush class=

Respuesta :

mynkiran mynkiran
  • 24-11-2018

21. Find the unit rate ($ per fl oz). Compare the two prices.

22. Multiply 2 3/5 by 7, and 5 3/4 by 4. Add those together and get the answer.


Hope that helps!

Answer Link

Otras preguntas

. Green swordtails are sexually dimorphic: males have a long, swordlike projection from their tails, and females have rounded tails. An experimenter decides to
What two cell types do complement proteins interact with, besides the pathogen itself?
What is a telomere? What happens to telomeres each time DNA is replicated? How do cells prevent this from occurring?
only question 4 thank you
Help me factor 5x^2-22x-15
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what is the main point being made by the cartoonist documeny E
Guys <br /> I want the word resolute and naturalization in a sentence separate
find three acids and three bases used in your home. 1) what are theses acids and bases used for? 2)look up the chemical name and chemical formula of each acid a
if an element has more than one ionic caves how was that piece of information represented in a chemical name?