sprinklyfluff1 sprinklyfluff1

26-03-2019
Mathematics

contestada

PLEASE HELP ASAP !!!what is the approximate volume of the cone use 3.14 for pi

PLEASE HELP ASAP what is the approximate volume of the cone use 314 for pi class=

Respuesta :

epicbow08 epicbow08

26-03-2019

Answer:

The volume would be 942

Cheers pal

Step-by-step explanation:

Answer Link

oKittso oKittso

26-03-2019

Answer: 942cm^3

Step-by-step explanation:

Ver imagen oKittso

Answer Link

Otras preguntas

7) At Elisa's Printing Company LLC there are two kinds of printing presses: Model A which can print 70 books per day and Model B which can print 55 books per da

how was sam houston passionate? give atleast 2 examples with explanation

how to solve these question?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

7) At Elisa's Printing Company LLC there are two kinds of printing presses: Model A which can print 70 books per day and Model B which can print 55 books per da

What two countries on opposite sides of the ring of fire were shaken by major earthquakes last weekend

Matt had to write 3 4/12 as an improper fraction right how you would tell Matt the easiest way to

1) If X = 2, calculate the value of: 2x squared - x 2) if X = -2, calculate the value of: 2x squared -x

Which of the following is a danger of exercising in cold temperatures? A. Dehydration B. Hypothermia C. Stroke D. Irritability

if an element has more than one ionic change how is that piece of information represented in the chemical name