hailscooper6493 hailscooper6493
  • 23-04-2019
  • Business
contestada

What is the term that refers to a form of wealth that can be stored for the future?

Respuesta :

MrsSeifried MrsSeifried
  • 25-04-2019

Answer: The correct answer is asset.

Explanation: An asset is a form of wealth that can be stored for the future. Assets can occur in any number of forms, but the trait that they all have in common is that they can be converted to cash. Assets may be in the form of cash, equipment, property, vehicles, or anything else that has value.

Answer Link

Otras preguntas

A major cause for gender inequality is believed to be (Points : 1) economic division of labor by gender. political leadership. women’
Explain which one of the above market control measures is applicable in the Labour market and justify why it is important to consider the effects of such action
can organisms naturally repair a mutation?
Which of the following statements about tuberculosis is FALSE? A.It usually affects the digestive tract. B. It responds to a long course of antibiotic treatment
---------- is the ability to do an activity for more than a few minutes. What is the blank?
f(x)= 3/x+2-square root x-3
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
1.What process is used to replicate the chromosomes? 2.Are the sister chromotids genetically identical? Explain.
14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?
Meaning of highland cow