trillestnaenaeburch
trillestnaenaeburch trillestnaenaeburch
  • 25-09-2019
  • English
contestada

Select the correct answer.
Is the boxed word a SUBJECT or a VERB?

The worst tornado in a century happened in Ohio.

A.
Subject
B.
Verb

Respuesta :

JinxLP
JinxLP JinxLP
  • 25-09-2019
What’s the boxed word?
Answer Link

Otras preguntas

Distinguish between eukaryotic and prokaryotic binary fission.
Females with the genotype X^CBX^cb (heterozygous for the red-green colorblindness allele) are rarely colorblind although some have only partial color vision. Sp
what's the possibility of choosing a spade in a deck of 52 cards?
which simple machines is NOT a wedge?
State two biological reasons why you consider that the loss of biodiversity matters.
Explain the relationship between osmosis and aquaporins.
Joe has eaten 3/5 of a pizza. Jane has eaten 1/7 of a pizza. How many times more pizza has Joe eaten than Jane in an improper fraction?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
In a recent year, certain colleges and universities received about $268 million in aid. Ten years later, they received about $94 million. Find the percent of ch
is gravity a field force