dianeDiane6276 dianeDiane6276
  • 24-01-2020
  • Business
contestada

Why would government officials need to restore confidence in the coins before people would sue them as money?

Respuesta :

Nanigoodlearning
Nanigoodlearning Nanigoodlearning
  • 27-01-2020

Answer:

At the microeconomic level there is confidence in the markets and people increase spending, leaving savings. Officials must demonstrate that they have knowledge of how to handle finances.

Appropriate services must be created in the cities and in this way at the social level, there will be confidence to increase overall spending.

Answer Link

Otras preguntas

Which name does the monk who travels to the west not use
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What's a simple method to find the cube root of a number ?
what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions
what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions
6 is 12% of what number
what two Georgians signed the united states constitution
of the 600 workers at a factory, 8.5% belong to a union. how many workers are in the Union?
Which sentence uses a verb that agrees with its subject? A. The time between Labor Day and Thanksgiving seem short. B. This map of the United States show
The role of media on reporting human rights violation