kayleighapough kayleighapough
  • 24-03-2020
  • Mathematics
contestada

If you needed only 1 cup of milk, what is your best choice at the grocery store—a quart container, a pint container, or a 1/2 gallon container?

Respuesta :

Аноним Аноним
  • 24-03-2020

Step-by-step explanation:

A pint container because there are 2 cups in a pint, whereas there are 6 cups in 1/2 gallon and 4 cups in a quart.

Answer Link

Otras preguntas

Give a related word or words. 1. batear 2. lanzar3. recibir 4. el jardín 5. el plato 6. encestar 7. jugar 8. volver
Solve with steps please giving brainliest -5x-16=9x+x-1
Assume that customers arriving at a DMV are requested to fill out an optional survey. Assume that one of the survey questions asks customers to rate the quality
write a polynomial for the volume of a cube with a side length of (x-1) inches.​
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA
white chocolates contain substances that stimulates the feeling of pleasure. true or false?​
Given the system of equation 7x-3y = 48 .......Eq 1 2x+ y = 35 ........Eq 2 __________ To solve this system by elimination and multiplication , i can ..........
Find the correct plugged in formula for each figure. *
A group of friends had dinner at a restaurant. The total bill for the dinner was $41 and they left a 15% tip. What was the total amount that they paid?
a rally car race course covers 515.97 miles the winning car completed the course in 6.5 hours.what was the average speed of the winning car?