Valeriachilbery08 Valeriachilbery08

24-04-2020
Chemistry

contestada

1. What do the arrows in a food chain or food web represent?

Respuesta :

dppphn04 dppphn04

24-04-2020

Answer:

The transfer of energy

Explanation:

When one organism eats another organism, energy is transferred.

Answer Link

darlene55986 darlene55986

24-04-2020

The transfer of energy

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Explain which one of the above market control measures is applicable in the Labour market and justify why it is important to consider the effects of such action

Find the mean of these values 6,4,8,2,5

George tells you that when variables are in the denominator, the equation four over five plus three over x equals one over two becomes unsolvable. George explai

Elaine bought a total of 15 shirts and pairs of pants. She bought 7 more shirts than pants. How many of each did she buy?

What name was given to the Allied plan to invade France?

The price of a new car is 16000$ Mr Mar paid 15% of the price as a down payment how much does he still owe? (Please help and explain)

Sarah's class recycled 3. 7 7/9 boxes of paper in a month. If they recycled another 9 2/8 boxes the next month what wasvthe total amount recycled

What does Frankenstein do to make his discovery about the source of life?

1+4=5 2+5=12 3+6=21 8+11=?