delilahhuynh delilahhuynh

22-09-2020
Mathematics

contestada

45% of the class is girls. There are 90 girls in the class. How many students are
in the class?

Respuesta :

breaknetwork breaknetwork

22-09-2020

Answer:

189

Step-by-step explanation:

45% x2= 90%

10% of 90= 9

90+90=180

plus that 10%

180 + 9 = 189

sorry if I'm wrong I'm trying

Answer Link

Otras preguntas

what is double fertilisation

Can someone help me with this? I also would like to understand so if you can show me step by step, that'd be great

DNA tacaggtacccgaacccaattta

simplify 9/2. heeelllpppp i dont know

During what period did Spain come under Muslim rule?

The box plots show the high temperatures in June and August for Denver in degrees Fahrenheit.

The function can be used to find the volume of air inside a basketball given its radius. What does V(r) represent? the radius of the basketball when the volume

Why is the cell theory considered a scientific theory? A. It was proposed by several scientists. B. It is an explanation that is well supported. C. It has a

The expression "an established fact" refers to _____. given information postulates definitions a theorem that has already been proven Ω

50 points please help asap is survival and vacate synonyms or antonyms or the words dont have a relationship or they share a cause and effect relationship need