montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

Can someone translate this into a verbal expression 3(4j + 4 + j)?

This was the name of a group of colonial women in the 1760s and 1770s that participated in the boycotts against the british following the townshend acts.

I was asked to replicate a work of Frida Kahlo for s project.What would be a good title for a copy of the painting "Self-Portrait with Necklace of thorns and Hu

If f(1)= 10 what is f(3)

Cathy is planning a reception for her daughter's wedding. all of the family is invited, but not all of the family members get along particularly well. cathy mus

probability mass function. f(x) = (125/31)(1/5)^x find F(1) F(2) P( X less or equal to 1.5) P (X>2) P(1 < X less or equal to 2

what might you do while you sleep that would cause you to see scenes in your mind? in spanishA. Sonar B. BailarC. Cantar D. Escribir

name the popular types of dinosaurs?

Charles needed 3/4 cups of rasins. if he has a 1/4 measuring cup, how many times will he need to fi'll it up to get to the right amount of raisins?

a stone is thrown upward from ground level with what minimum speed should the stone be thrown so as to reach a height of 9 feet? ***This is a calculus problem N