allsmiles1983 allsmiles1983
  • 23-09-2016
  • Mathematics
contestada

how much is 4oz to a cup?

Respuesta :

mommajenx4 mommajenx4
  • 23-09-2016
1/2 cup. 8oz is 1 cup
Answer Link

Otras preguntas

The Glorious Revolution of 1688 demonstrated that Parliament had
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
find the quotient of 3870 and 18
What event takes place in the second entry of Anne Frank's dairy?
Which lines in this excerpt from Mary Otis Warren's poem "A Political Reverie" use figurative language? I look with rapture at the distant dawn , And view the g
E. coli (K12) has a genome size of 4,639,675 bp in one chromosome that encodes for 4,435 proteins. The average size of these proteins is 330 amino acids. What p
What does the term human rights mean
Suppose a pizza must fit into a box with a base that is 12 inches wide. You can use the quadratic function a=(Pi)r^2 to find the area of a pizza in terms of its
how many branches of government are dictated in the us constitution,what are those branches??
What are the three differences between The Quran and the Gospel??