autumnlevi10
autumnlevi10
22-10-2020
Mathematics
contestada
Define a direct variation equation
Respuesta :
mooreally30
mooreally30
22-10-2020
mathematical relationship between two variables that can be expressed by an equation in which one variable is equal to a constant times the other.
Answer Link
VER TODAS LAS RESPUESTAS ( 15+ )
Otras preguntas
The length of the iland top i 35. 5 inche. The width of the iland top i 46. 75 inche. What i the area henry' rectangular kitchen iland top? Ue paper to how etim
This Is The Light Intensity On A Viewing Screen Behind A Slit Of Width A. The Light's Wavelength Is λ. is λa, or is it not possible to tell?
Some conservation biologists focus on areas where the greatest number of unique species can be protected with the least amount of effort. These areas are called
The average weight of five cats is 5.2 kg. The weights of four of the cats are 5.4 kg, 5 kg, 4.8 kg, and 4.9 kg. Find the weight of the fifth cat.
Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?
Biotic factors are the?
Individuals who manage to succeed and thrive despite many difficulties may best be described as ____. a. being resilient b. immune to stress c. having autonomic
12. Juan is a programmer going to school at night to earn a higher degree. He starts the month with $500 in his savings account. His income is $4750. Each mont
in the distribution process, the largest percentage of the retail price goes to: a. transportation. b. warehouse costs. c. profits. d. labor.
 use the discriminant to determine how many and what kind of solution to quadric equation X ^2- X = -1/4 
