wilsonjeremiah672 wilsonjeremiah672

22-10-2020
Geography

contestada

how can I contribute to the understanding of our universe

Respuesta :

Аноним Аноним

24-10-2020

Answer:By doing your own research and your own theories on the universe .

Explanation:

Answer Link

Otras preguntas

Read this sentence. The pushy salesperson wanted us to buy the merchandise. Based on the context of the sentence, which word gives it a negative connotation?

1-10 are True or False (This is Environmental Science not physics) 1). an oil rigs searches for and finds oil reservoirs. 2). The volume of oil in one barrel is

There are 24 markers in a box. Nine of the markers are fine-tip and the rest are bold-tip. What is the ratio of fine-tip markers to bold-tip markers? 3:

How did Americans come to serve in Vietnam? How did the draft work? Why did the draft anger many Americans? Write your answer in a paragraph of 125 words.

The process of making mRNA

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Which function is an example of exponential growth? y = 2(0.3)x y = 1.5(0.4)x y = 3(8)x y = 2(0.7)x

H2SO4 + 2NH4OH → (NH4)2SO4 + 2HOH Which of these would be the BEST description of this reaction? A) reduction B) combustion C) neutralization D) single

x= a) 80 b) 90 c) 100

Does anyone know how to do this if so can u help me out.