Marleighjilaha1 Marleighjilaha1
  • 22-10-2020
  • Chemistry
contestada

A pure substance with one type of atom is called a(n) ______________.

options:

molecule


element

Respuesta :

Pynshongnia227 Pynshongnia227
  • 22-10-2020

Answer:

I think the answer is element

Explanation:

Because molecule is a small substance not pure see the difference between small and pure.

Answer Link

Otras preguntas

Who is Barbare Sonek?
Factor polynomial: 5x^2+21x+4=0
what number should be added to the expression to turn it into a perfect square trinomial x^2+2x
Pedro tapes a 3 5/6 piece of paper to a 2 3/4 inch of piece with no overlap. how long is the piece of paper he made?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
one reason President Johnson created the Great Society program was to
When parietal cells secrete protons into the stomach, what would you predict would happen to the pH of the blood? Would this process be affected if you treated
Need to know if these are correct, and if not what are the correct ones?
Explain the relationship between osmosis and aquaporins.
1+4=5 2+5=12 3+6=21 8+11=?