Rebecca1995x Rebecca1995x
  • 24-02-2021
  • Mathematics
contestada

Need to work out how many people over the age of 44 were chosen for the survey

Need to work out how many people over the age of 44 were chosen for the survey class=

Respuesta :

ahmed2007 ahmed2007
  • 24-02-2021
29 need to work it and over fiber
Answer Link

Otras preguntas

Helpppppppp plzzzzzzzz10points
who was the aztec leader in 1519 A) chief joseph B) sitting bull C) montezuma D) atahualpa
What is the economic and societal impact of bacteria? Why is it and has been so important for bacteria to evolve?
Determine whether the function below is and even function, an odd function, both, or neither. Function: f(x)=x^6+10x^4-11x^2+19 A. neither even nor odd B. both
DNA in the nucleus is found in structures called _____. organelles pores ribosomes chromosomes
what most attracted the founding father's to montesquieus explanation the separation of powers
the solvent agent for oils is?
DNA tacaggtacccgaacccaattta
I have to describe what our generation is about and I need help with 1.Goverment (just describe what our government is in this generation.)
Using the following biomass data, determine which groups is most likely to represent the producers in an area. Group A- 1.5 Kg Group B- 11 Kg Group C- 37 Kg Gro