imslowhelpmelol imslowhelpmelol
  • 26-02-2021
  • Mathematics
contestada

help me with this please

help me with this please class=

Respuesta :

Аноним Аноним
  • 26-02-2021

Answer:

i think its the second one

Step-by-step explanation:

Answer Link

Otras preguntas

Share 120 in the ratio 3:5:7
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
If the coordinates of one vertex of a triangle is (-4,-1), what will be the its new coordinates if the triangle slides 6 units to the right?.
How are the causes of mudslides and erosion different
The weather broadcast gives us ........... about how the weather is going to be. 1. the information 2. informations 3. an information 4. information​
What was the object photographed in the first known color photograph? Group of answer choices a ribbon a book a tree a fence
Find x- and y-intercepts of 4x + 2y = 10
A measure of the average value of a random variable is called.
Which statements describe haiku? check all that apply.
The function f(x) is shown graphed below. The function g(x) is defined by the formula: g(x)=-4f(x)+7 What is the value of g(3)?