tanyasingh21 tanyasingh21

26-03-2021
Biology

contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946 annaclaire946

26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

what is the numerical expression for half the sum of 11 and negative 3andthe absolute value of negative 62

Cassandra drove 370.5 Miles in 6.5 hrs. How many miles per hour did she drive? (:

Explain how the types of mountain landforms are related to one another.

Explain how can you use the Associative Property to evaluate (7*50)*4.

What characteristics separate algae from a) protozoans and b) plants?

How are ice and water involved in mechanical weathering

Why can't you change the subscripts in a formula in order to balance a chemical equation?

What is a protein? Describe the monomers and polymers of protein? What are the functions of proteins? What atoms make up proteins?

kelly is 66 inches tall. Lucas is 72 inches tall. What is the ratio of Lucas's height to Kelly's height in simplest form? (: also, explain please!

What is the total energy of a 175,000kg shuttle orbiting the Earth at 600km above Earth's surface?