tianavmora tianavmora
  • 22-04-2021
  • Mathematics
contestada

Does the mean or median best describe a typical value in the data set shown?19, 18, 19, 18, 19, 19, 1, 19, 18, 19, 18

Respuesta :

anthonywilliams85
anthonywilliams85 anthonywilliams85
  • 22-04-2021

Answer:

Probably mean.

Step-by-step explanation:

The median is the middle number (in this case, 19) and the mean is the average of all the numbers

Answer Link

Otras preguntas

When faxing sensitive compartmented information (sci), what actions should you take?.
SPANISH PLEASE HELP Which phrase best completes the sentence? Marcos no es _____. A. un estudioso chico B. un chico estudioso C. chico un estudioso D. estu
SPANISH HELP Which word best completes the sentence? Pablo es reservado y le gusta estudiar. Pablo es _____. A. gracioso B. atrevido C. serio D. sociable
How can I solve for t?
Between 1981 and 1984, President Reagan doubled the: A. Living space in the White House. B. Budget for welfare programs. C. Defense Department's budget D. None
how do you write narrative framework
Which two natural resources are readily available in Central Asia? gold and uranium coal and copper oil and diamonds timber and iron ore
I need help on this math question
SOMEONE PLEASE HELP WILL MARK BRAINLIEST
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):