unofficialartist unofficialartist

22-04-2021
Social Studies

contestada

Which term refers to showing more white people than people of color on television and in movies?
A. White superiority
B. White imperialism
C. Whitewashed
D. White privilege

Respuesta :

damrow51 damrow51

22-04-2021

I feel like it’d be white imperialism

Answer Link

escoreyna16 escoreyna16

06-05-2022

Answer: B: White Washed

Explanation:

Answer Link

Otras preguntas

If you drink a soda with sugar, what happens to your blood glucagon levels?

A cargo plane flew to Moscow and back. It took six hours longer to go there than it did to come back. The average speed on the trip there was 152 mph. The avera

The physical environment (for example, our living spaces) that we, as individuals, create __________________. a. is unrelated to our communication b. reveals in

Which of the following is an example of a “smart” exercise choice? Wear extra layers of clothing Swim where a lifeguard can see Prepare large meals beforeha

the sale price of a bicycle is $120 this is 75% of the original price find the original price

A number triple and tripped again is 729 what is the number show workings

What are the three differences between The Quran and the Gospel??

The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri

What is double consciousness

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC