susanaveles61 susanaveles61
  • 24-05-2021
  • Mathematics
contestada

cuales son los pro nombres personales​

Respuesta :

JustinMontelfalco22
JustinMontelfalco22 JustinMontelfalco22
  • 24-05-2021

Answer:

Estos pronombres presentan distintas formas, pues dependen de la persona gramatical, el género y el número. Ellos son: yo, tú, vos, usted, él, ella, nosotros, nosotras, ustedes, vosotros, vosotras, ellos y ellas.

Answer Link

Otras preguntas

Which of the following is a danger of exercising in cold temperatures? A. Dehydration B. Hypothermia C. Stroke D. Irritability
what are the 3 care instructions for future life on earth
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Tensile strength of a wound is directly related to the
A patient received a new heart transplant, but shows signs of graft rejection after 2 weeks. Which type of hypersensitivity reaction is in progress?" a) Type I
Can anyone to correct it if necessary?
What type of triangle is this?
What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite
Does old age means end of life according to A Tennyson in Ulysses
a dime is flipped and a six-sided die is rolled what is the probability of flipping heads and rolling an odd number