latinaanamay
latinaanamay latinaanamay
  • 22-06-2021
  • Mathematics
contestada

which of the following is equivalent to 2 stretching below? (14-9i)+(2+3i)..​

Respuesta :

Muscardinus Muscardinus
  • 27-06-2021

Answer:

(14-9i)+(2+3i) = 16-6i

Step-by-step explanation:

We need to find the equivalent of (14-9i)+(2+3i).

We need to add the two expressions.

(14-9i)+(2+3i) = 14+2 -9i+3i

= 16-6i

Here, the real part is 16

The imaginary part is -6

Hence, the required answer is equal to 16-6i.

Answer Link

Otras preguntas

A comparison of 2 numbers is a
A horizontal force of 5. 0-n accelerates a 4. 0-kg mass, from rest, at a rate of 0. 50 m/s^2 in the positive direction. What friction force acts on the mass? *
The terms of the Adams-Onís Treaty in 1819 were made official when Foreign Minister Luis de Onís and US Secretary __________ signed the treaty. A. John Adams B.
Please select the word from the list that best completes the sentence. Having a(n) _____ in the status quo can cause a person to become resistant to change.
A woman of mass 60 kg is standing in a lift at a shopping centre. The lift is at rest. The lift is at rest.? State the value of the weight of the woman. Calcula
Which model shows the product of the expression? A. 2 x 4/6 B. 2 x 6/4 C. 3 x 4/6 D. 3x 6/4 Due Today
I NEEEDD HELPPPP!!!!! PLEASE SHOW ALL WORK TOO!!!
can you form a triangle out of 90°, 70° and 30°? yes or no
PLEASE HELP ME mark brainliest if you’re correct
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT