LoomCyx
LoomCyx LoomCyx
  • 22-06-2021
  • Mathematics
contestada

Given:
WXYZ is a rhombus.



If 5 = 20°, then 1 =

20
40
70

Given WXYZ is a rhombus If 5 20 then 1 20 40 70 class=

Respuesta :

vincentelui
vincentelui vincentelui
  • 22-06-2021

Answer:

20

Step-by-step explanation:

alternate angles of two parallel lines WX and ZY

Answer Link
parkertrickey parkertrickey
  • 12-10-2021

Answer:

20!

Step-by-step explanation:

Answer Link

Otras preguntas

Which is not an improper fraction equal to eight
Marley has read 112.5 pages of a book. By the end of today, she plans to have read at least a total of 360 pages. If she reads 45 pages per hour, what is the mi
if you are given a 2% raise and inflation rate is 3% you are
is gravity a field force
The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that the length of DNA contained in e
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Suggest a reason why food labels provide information about the energy released by the food?
what percent of 137.4 is 96
Which of the following correctly describes SAM, a biological methylating agent? A) It contains a Cl bonded to a 1° carbon. B) It contains a methyl group bonded
Write your question here (Keep it simple and clear to get the best answer)what are the different types of bleaching agent's