jocelynloreto80068 jocelynloreto80068
  • 25-08-2021
  • Mathematics
contestada

Solve for p: p^2+4p-32=0

P=? (Smaller value)
P=? (Larger value?
Enter your answer in a single field, separated by a comma. Try different orders.

Respuesta :

tahseenyasmeen379
tahseenyasmeen379 tahseenyasmeen379
  • 25-08-2021

Answer:

hope it helps you.........

Ver imagen tahseenyasmeen379
Answer Link

Otras preguntas

If two solutions differ in their [H3O+] by a factor of 2.0, the difference in their pH will be 2.0.
What is the power output of an electric motor that lifts a 2.0 kilogram block 15 meters vertically in 6.0 seconds
a brown dog is crossed with two different black dogs. The first cross produced only black dogs and the second cross produces equal numbers of black and brown do
Water and minerals can follow three pathways to the vascular tissue of the root. Describe the three pathways.
how to solve these questions?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
6. Why is crossing over, or recombination, in meiosis a genetic advantage for a n organism? Why is crossing over an advantage for a geneticist
Is 0.444444444444444... a rational number? explain is 0.35435543554... a rational number? explain
Please I need help quickly I'm on a time limit
Which statement is true for single-celled organisms