raphealgrant200 raphealgrant200
  • 24-01-2017
  • Biology
contestada

why the populations decrease between July and December

Respuesta :

animegirl1
animegirl1 animegirl1
  • 24-01-2017
There are two reasons that seem logic from this graph. First, towards the winter, the animal population decreases as some of them die or emigrate from their ecosystem. And the second main reason is that the breeding stock is not active toward th months of July to December, so as there are no breeding stock, then less animal population may born by that time
Answer Link

Otras preguntas

2. Students are asked to sequence the order of the seasons using picture cards. Which group of students sequenced their picture cards correctly? winter summer s
Which of the following is an example of a “smart” exercise choice? Wear extra layers of clothing Swim where a lifeguard can see Prepare large meals beforeha
What is the color of the stars with the lowest surface temperature
Consider the combustion of octane (C8H18) 2C8H18+25O2-> 16CO2+18H2O How many grams of CO2 are produced when 191.6g of octane are burned?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
How many times dose 63 go into 359
in millions of british pounds how much did germany spend in 1890
​What is the primary way that combination birth control pills work to prevent pregnancy?
The question is in attachment
PLEASSE HELP ME WITH THIS