Seudónimo Seudónimo
  • 22-02-2017
  • Mathematics
contestada

Pleaaaaseeeee hellllpfor BRAINLEST answer and thanks

Pleaaaaseeeee hellllpfor BRAINLEST answer and thanks class=

Respuesta :

Ozzy101
Ozzy101 Ozzy101
  • 22-02-2017
I'm pretty sure the answer is 3
Answer Link

Otras preguntas

Please Help! Car X travels 174 miles in 3 hours.
A frozen yogurt shop allows guests to fill a cone shaped cup with frozen yogurt, and customers pay $0.08 per cubic inch. If each cup has a radius of 3 inches an
NEED HELP!! Didn’t mean to click that answer
What is the domain of the quadratic function f ( x ) = x 2 − 4 x + 3
When proteins unfold due to changes in temperature or pH, they _______________ (pick 2 responses) continue to function don't work anymore denature refold into a
Pleaseeeee answer I will mark brainliest for best answer ^>^
find the value of given expression=》[tex] \frac{ \sqrt{64} }{16} [/tex]​
1. What do cartoon objects symbolize?
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA
What holds sand togehter against wind erosion?