elias45
elias45 elias45
  • 26-02-2017
  • Mathematics
contestada

I don't understand the problem

I dont understand the problem class=

Respuesta :

MathDestruction
MathDestruction MathDestruction
  • 26-02-2017
Any plot on the circle will be a distance of 2 from the center. If we plot 4 dots on the circle then that's 4 lines connecting towards the center. And that's 2+2+2+2 = 8
Answer Link

Otras preguntas

describe the boston massacre
help me in this plis​
The price of a knife increased by 10% to 550.The price of a rake previously 600 was increased by x% . Find the value of x given that the percentage increase for
paragraphs 19, 35, and 73-75 how does the white couple moving in behave towards dante, shay, and her family
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Where does the carbon come from in an ecosystem
cual opcion es visible al ojo humano a simple vista kilogramo molecula mol atomo gramo
I need help with geometry
Given the binary file format: The file contains a sequence of blocks representing fractions. Each block contains three parts: the first byte represents positive
que paises de europa hablan lenguas romanicas