amymartinez30 amymartinez30
  • 23-03-2017
  • Biology
contestada

How do preserved fossils form

Respuesta :

kaylee3040
kaylee3040 kaylee3040
  • 23-03-2017
I think its sedimentation
Answer Link

Otras preguntas

THE CASE (adapted from “Shark Attack” by H. House) 8 year-old Jim Morris was swimming the Gulf off of Florida. While swimming, Jim was bit in the arm by a bull
Kohlberg believed that human moral development is strongly based on the fact that we all have a desire for justice and a(n) __________. A. impartiality for fair
Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.
The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri
A sales tax of 6% is added to the price of an item.If Marisa buys an item which expression indicates how much she will pay in all.A,n+0.06,B,0.06n,C,n+0.06n or
If 1+4=5; 2+5=12; 3+6==21; what is 8+11
Mrs. Gannon is having her class make a winter decorations using pine cones. If each decoration needs 11 pine cones and Mrs. Gannon ha 18 students in her class.
if an element has more than one ionic caves how was that piece of information represented in a chemical name?
what type of sentence tends to express a strong emotion
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC