Samara89 Samara89

23-05-2017
Mathematics

contestada

In rhombus ABCD, find the measure of angle D. A) 142° B) 52° C) 38° D) 218°

In rhombus ABCD find the measure of angle D A 142 B 52 C 38 D 218 class=

Respuesta :

help4402 help4402

23-05-2017

A)142 in rhombuses opposite angles are congruent.

Answer Link

Otras preguntas

Use the information given to answer the question. A factory makes rugs at a constant rate of 10 rugs every 4 hours. Part A How long does it take the factory to

Which law did congress pass to prevent abuses arising from business arrangements such as the one above?.

Give an example of a scientific theory. PLEASE HELP!!!!! :)

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

If a horse retina cell has 36 chromosomes, how many chromosomes does a horse sperm cell contain?

The client's dosage is reduced from 75 mg to 25 mg. What is the percentage decreas

a glacier retreated 9.36 meters in 3 months. If the glacier reatreated the same number of meters each month, how many meters did it retreat i one month

What do you think caused the demand for slaves to rise from the 1500s to the 1600s

Elige la opción adecuada. 1. Acción de perder peso. O adelgazar Oengordar 2. Persona que ve la televisión en exceso. O sedentarlo O teleadicto 3. Sustancia exci

Which statement best describes historical criticism?.