manamanamanmh8848 manamanamanmh8848

24-05-2017
Biology

contestada

The stomach is full of hydrochloric acid, which kills bacteria in food.

True
false

Respuesta :

Emily446 Emily446

05-06-2017

True, Your stomach makes it naturally to help digest.

Answer Link

Otras preguntas

Consider an economy with only two groups of people: Wage earners and Goods sellers. If the price level increases by 20% while the nominal wages remains the s

How did Italian merchants being the practice of fractional reserve banking?

r divided by 5/6 equals 9/10 What is the r value

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

Which of the following statements is not correct? a. Trade has potential to benefit all nations b. Trade allows nations to consume outside of their production p

At January 1, 2020, Culver Inc. had accounts receivable of $69,000. At December 31, 2020, accounts receivable is $54,000. Sales revenue for 2020 total $422,000.

Suppose the interest rate is 4.0 %. a. Having $ 200 today is equivalent to having what amount in one year? b. Having $ 200 in one year is equivalent to having

Write 15% as fraction or mixed number in simplest form

The temperature at a point (x, y) in the plane is T(x, y) ◦C. If a bug crawls on the plane so that its position in the plane after t minutes is given by (x(t),

Write a short paragraph (at least five sentences) describing what you have learned or how you are reacting to this trial and the issues related to it. For topic