marcusdavis286 marcusdavis286

24-05-2017
Mathematics

contestada

A fabric store cut 2,160 inches of ribbon into 12 pieces.

How many yards long was each piece?

Respuesta :

morganalphin morganalphin

24-05-2017

Each piece is 5 yards long.
Divide 2160 by 12 then by 36 to get 5.

Answer Link

Аноним Аноним

24-05-2017

Okay well let's first change 2160inches into yards (3 feet=36inches ,) 2160÷36=60 do 60 yards, now we find how many yards are in each of the 12 strips we divide by twelve, 60÷12=5 ANSWER: each strip is 5 yards

Answer Link

Otras preguntas

In a population of skunks, there are striped and stripeless individuals. Stripes are dominant to the absence of stripes. In this population, p = 0.8 and the fre

Can somebody please explain to me how the acceleration in simple hormonic motion is proportional to the displacement..

What's 165% as a fraction and decimal

Find the smallest zero for the function h(x) = 4x^2 - 8x - 60

Hydrogen peroxide decomposes to give water and oxygen gas according to the equation below. If 3.0 moles of hydrogen peroxide decompose, what volume of oxygen ga

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

. If a human has not eaten in 6 days,

Tensile strength of a wound is directly related to the

what number must you add to the polynomial below to complete the square? x^2-x A. 1/4 B. 1/2 C. 2 D. 1

Please help me with this question