tiffanybrimlowoyaq84 tiffanybrimlowoyaq84

23-10-2017
Mathematics

contestada

find the value of the underlined 9 10,698

Respuesta :

23-10-2017

90-------tenths place

Answer Link

Otras preguntas

20 points Approximately ___ of the world's oil is controlled by OPEC. 10% 45% 75% 90%

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Which of the points given divide the line segment AB in the ratio 2:3?

How did replacing Roosevelt's secretary of interior cause a dispute between Taft and progressives

Which of these activities can help protect sea turtles and other aquatic organisms? A. Recycling electronics B. Reusing water bottles C. Buying recycle

Which Australian industry experienced a major "boom" in the first decade of the 20th century? s (A) aircraft (B) automobile (C) gold mining (D)

Which of these is MOST LIKELY to contribute to the long-term instability of a local ecosystem? A) storms that uproot large trees in the area B) introduction of

You buy 6 pounds of apples for $33. What is the cost of 10 pounds of apples?

When a pollutant is removed from the air by a natural process it_____? Distrupts natural processes Ends up elsewhere Is gone forever Causes chemical reaction

Find the value of x. Right triangle: Hypotenuse is 11, base is x, angle is 22 degrees.