traceylynne521p29jmg traceylynne521p29jmg
  • 22-01-2018
  • Mathematics
contestada

To find the difference of 7- 3 5/12, how do you rename the 7?

To find the difference of 7 3 512 how do you rename the 7 class=

Respuesta :

graciej55p16fwb
graciej55p16fwb graciej55p16fwb
  • 22-01-2018
I think they mean how to make it an improper fraction. My guess would be 7 over 1, but I could be wrong.
Answer Link
Аноним Аноним
  • 22-01-2018
Make it 7/1. You cannot work this without turning it into a fraction. It wouldn't be 1/7, because it is not 1 peice of 7, it is the whole thing. 7/1.I would also turn 3 5/12 into a mixed fraction. That would be 41/12.
Answer Link

Otras preguntas

which one of the statements is true
Mantle convection is a circulation of heat emitted by the earths... A) core B) crust C) lithosphere D) atmosphere
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What might "tangible artifacts" tell us about the Shang?
which process do scientists think provided earth with an oxygen- rich atmosphere
How many times dose 63 go into 359
Who discovered polio vaccine
Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestive cavity with a single opening
If you drink a soda with sugar, what happens to your blood glucagon levels?
Please help me with this question