croitru7857 croitru7857
  • 25-02-2018
  • Biology
contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422
  • 25-02-2018
gtaaccatccgttttcttga
Answer Link

Otras preguntas

choose the best verb to fill in the blank: the graceful moves of the dancer _____ the audience which sat uncommonly still throughout the performance. A) bewitch
What is the remainder when (x3 1) is divided by (x2 â€"" x 1)?.
why is international employment important​
2x2 +5x+8 Given x 3-2, the expression x+2. is equivalent to
Tom is not sure how to code contents such as title and meta elements. These are coded as ____ elements.
What is the definition of confederation, and constitution??
31) A __________ predicts overall natural events in general terms, while a __________ is a very specific prediction based on one circumstance.
Écrivez une conversation entre vous et le vendeur ou la vendeuse d'un magasin des vêtements des femmes.
What is the image point of (1,4) (1,4) after a translation left 5 units and down 5 units?
A piece of metal with a length of 2. 83 cm was measured using four different devices. Which of the following measurements is the most accurate? 2. 837 cm 2. 829