mcoleman0310 mcoleman0310

25-05-2017
Business

contestada

( missing a word ) When individuals are looking for jobs but are unable to find work, they are said to be______.

Respuesta :

WeatheringWithYou WeatheringWithYou

25-05-2017

This term is called unemployment.

Answer Link

lauraloony1 lauraloony1

25-05-2017

when individuals can not find work they are said to be Unemployed

Answer Link

Otras preguntas

what two elements are highlighted on group 3 of the periodic table

ayo the pizza here is a classic vine but what is the video trying to confict?

Please Help Me ASAP The coordinates of point J are (5, −6) and the coordinates of the point K are (7, 8). What are the coordinates of the point one half the dis

A system of mass 13 kg undergoes a process during which there is no work, the elevation decreases by 50 m, and the velocity increases from 15 m/s to 30 m/s. The

Explain the viewpoints of the two groups that opposed the war. PLZZZZZZZZZZZ!!!!!!!!!! HELPPP!!!!!!!!!

What's the difference between a business vision statement and business strategic objectives?

two examples of compounds and compare their properties

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Which equation is true if s = -3

In this passage, what happens to Smith and his family? They are moved to another plantation. They are broken apart when Smith is sold to another owner. O They a